Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: scssr10477

[Submit comment/correction]

Locus	scssr10477
Type	Microsatellite SNP
Synonym	Other name Ctig5280 Synonym ABC10477_L02R02
Chromosome	1H
Map	Barley-ConsensusFHB-1H 84.36 [ Show all 7 ]
	[ Show Nearby Loci ]
Map Data	Barley, Abiotic QTL Consensus [ Show all 7 ]
Species	Hordeum vulgare
Probe	ABC10477_L02R02 scssr10477
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Ramsay L et al. (2004) Variation shown by molecular markers in barley: genomic and genetic contraints Aspects of Applied Biology 72:146-154.
Data Source	Russell, Joanne
Remark	[ Hide all but 1 of 6 ] Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Oregon Wolfe Barleys Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : OWBrecessive x OWBdominant Insert contains repeat (GAG)4 Polymorphic Information Content (PIC) = 0.82 Developing laboratory = SCRI (R. Waugh)
Probe for Locus	ABC10477_L02R02
Locus	scssr10477
Data at Germinate	ABC10477
Data at PLEXdb	Barley1_10477
General Remarks	Estimated product size = 150 BarleySNP type = Contig Indel Technology platform used = Radioisotope Labelled PCR Separation Affymetrix contig name = abc10477
PCR primers	5' AGAGCAATGAGCTCCTACCC 5' GCTTACTCGCTCGTTTAGTCG
Sequence	Barley1_10477
Source Species	Hordeum vulgare