Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: TraesCS7D01G080200

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	TraesCS7D01G080200
Locus	TraesCS7D01G080200.1
URL	[ Hide all but 1 of 12 ] Pfam PF00083 InterPro IPR003663 InterPro IPR005828 InterPro IPR005829 InterPro IPR020846 Gene Ontology GO:0005215 Gene Ontology GO:0016020 Gene Ontology GO:0016021 Gene Ontology GO:0022857 Gene Ontology GO:0022891 Gene Ontology GO:0055085 Gene expression at wheat-expression.com (expVIP)
Reference	Fang T et al. (2020) Development and deployment of KASP markers for multiple alleles of Lr34 in wheat Theoretical and Applied Genetics 133:2183-2195. IWGSC et al. (2018) Shifting the limits in wheat research and breeding using a fully annotated reference genome Science 361.
General Remarks	BLAST Hit Accession: tr|B9R9W6|B9R9W6_RICCO Human Readable Description: Sugar transporter, putative Pfam IDs Description: PF00083: Sugar (and other) transporter InterPro IDs Description: IPR003663: Sugar/inositol transporter; IPR005828: Major facilitator, sugar transporter-like; IPR005829: Sugar transporter, conserved site; IPR020846: Major facilitator superfamily domain GO IDs Description via InterPro: GO:0005215 MF: transporter activity; GO:0016020 CC: membrane; GO:0016021 CC: integral component of membrane; GO:0022857 MF: transmembrane transporter activity; GO:0022891 MF: substrate-specific transmembrane transporter activity; GO:0055085 BP: transmembrane transport
Type	Genomic PCR
PCR primers	Forward 5' AGCGTCGTCGGCGTCTC Reverse 5' GCAGGAAAGGCTCCATGGACA
Sequence	TraesCS7D01G080200.1
Source Species	Triticum aestivum
Source Germplasm	Chinese Spring