Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Probe Report: TraesCS7D01G080300

[Submit comment/correction][What is a probe?]Probes originated as records of the single stranded molecules used in RFLP mapping. This term has expanded to include PCR primers and SNPs.

Note: Probe report page includes probe information, gene models, PCR Primers, and SNPs.

Probe	TraesCS7D01G080300
Locus	TraesCS7D01G080300.1
URL	[ Hide all but 1 of 14 ] Pfam PF14510 Pfam PF00005 Pfam PF01061 Pfam PF08370 InterPro IPR003439 InterPro IPR003593 InterPro IPR013525 InterPro IPR013581 InterPro IPR027417 InterPro IPR029481 Gene Ontology GO:0005524 Gene Ontology GO:0016020 Gene Ontology GO:0016887 Gene expression at wheat-expression.com (expVIP)
Reference	Fang T et al. (2020) Development and deployment of KASP markers for multiple alleles of Lr34 in wheat Theoretical and Applied Genetics 133:2183-2195. IWGSC et al. (2018) Shifting the limits in wheat research and breeding using a fully annotated reference genome Science 361.
General Remarks	BLAST Hit Accession: tr|W0TSU1|W0TSU1_ACAMN Human Readable Description: Pleiotropic drug resistance ABC transporter Pfam IDs Description: PF14510: ABC-transporter extracellular N-terminal; PF00005: ABC transporter; PF01061: ABC-2 type transporter; PF08370: Plant PDR ABC transporter associated InterPro IDs Description: IPR003439: ABC transporter-like; IPR003593: AAA+ ATPase domain; IPR013525: ABC-2 type transporter; IPR013581: Plant PDR ABC transporter associated; IPR027417: P-loop containing nucleoside triphosphate hydrolase; IPR029481: ABC-transporter extracellular N-terminal domain GO IDs Description via InterPro: GO:0005524 MF: ATP binding; GO:0016020 CC: membrane; GO:0016887 MF: ATPase activity
Type	Genomic PCR
PCR primers	Forward 5' AAGCATCTAACATCATTGCTG Reverse 5' CCAATCCAAAAGCGATATAAAATAAG
Sequence	TraesCS7D01G080300.1
Source Species	Triticum aestivum
Source Germplasm	Chinese Spring