Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: 84c21j33

[Submit comment/correction]

Locus	84c21j33
Chromosome	6H
Map	Hordeum-Consensus2005-SNP-6H 7.168 Hordeum-LiHs-SNP-6H 90.34 Hordeum-QTLConsensus-Abiotic-6H 7.17 Hordeum-QTLConsensus-Agronomic-6H 7.17
	[ Show Nearby Loci ]
Map Data	Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, Consensus 2005, SNP Barley, Lina x H.spont, SNP
Reference	Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Probe	84c21j33
Locus	BAC84c21_s33
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Cardle L et al. (2000) Computational and experimental characterization of physically clustered simple sequence repeats in plants Genetics 156:847-854.
Type	SSR
PCR primers	AATCCCTCTTCATAAATTAGTG TCCAAATCACTGAACAAAAAC