Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABC165

[Submit comment/correction]

Locus	ABC165
Type	RFLP
Synonym	Synonym ABC165
Chromosome	2H
Chromosome Arm	2HL
Map	Barley-consensus-2003-2H 140.1 [ Show all 20 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	MetaQ.FHB_6H_13 QHt.StMo-2H.2 QLg.StMo-2H.2
Map Data	Barley consensus [ Show all 19 ]
Probe	ABC165
Reference	Close TJ et al. (2009) Development and implementation of high-throughput SNP genotyping in barley. BMC Genomics 10:582. Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Blake, Tom 05.04.19 Close, Timothy J. Langridge, Peter J.
Remark	Number of populations contributing to the placement of ABC165 in the Barley, Consensus 2006 DArT maps = 1
Possible Orthologs	ABC165-2H ABC165A ABC165C ABC165D
Probe	ABC165
Locus	ABC165 ABC165C ABC165D ABC165A ABC165-2H
External Databases	DDBJ EMBL GenBank
Remarks	Steptoe malt cDNA
Type	cDNA STS
PCR primers	CAATGACTTCAAGGGGTCTG TCCATACCATTCCCATCTAA
Sequence	L43932
Linkage Group	Group 2 2
Source Species	Hordeum vulgare
Source Germplasm	Steptoe (barley)
Source Tissue	malt
Insert Size	0.5