Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABC253

[Submit comment/correction]

Locus	ABC253
Type	RFLP STS
Synonym	Synonym ABC253
Chromosome	7H
Map	Barley-Consensus2-7H 119.5 [ Show all 18 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QDp.HaTR-7H QFcd.HaTR-7H QTw.HaTR-7H.2
Map Data	Barley consensus 2 [ Show all 18 ]
Probe	ABC253
Reference	Szucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140. Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Mesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318.
Data Source	Kleinhofs, Andris
Remark	Number of populations contributing to the placement of ABC253 in the Barley, Consensus 2006 DArT maps = 1 This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Oregon Wolfe Barleys Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Oregon Wolfe Dom x Rec
Probe	ABC253
Locus	ABC253
Synonym	Synonym HAR35_23980
External Databases	DDBJ EMBL GenBank
Type	STS
PCR primers	AGGGAATGCAGATCTCACAC GCATGGTGACAGATTTCAAA
Sequence	L43938 ABC253
Source Species	Hordeum vulgare