Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABG316f

[Submit comment/correction]

Locus	ABG316f
Type	RFLP
Chromosome	1H
Map	Barley-Consensus2-1H 29 [ Show all 6 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus 2 [ Show all 6 ]
Probe	ABG316
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs	ABG316 [ Show all 7 ]
Probe for Locus	ABG316
Locus	ABG316f [ Show all 8 ]
Synonym	Please see p13XB(1.1) Synonym HAR35_31000
External Databases	DDBJ EMBL GenBank
General Remarks	The 2.4 kb fragment from this clone is ABG319.
Type	Genomic STS
PCR primers	CCAATTGTGTGAATGGATGT CGTAAGAAGGAGAAGATGAC
Sequence	L43975 ABG316
Linkage Group	3 Barley 7 (5H) 2
Source Species	Hordeum vulgare
Insert Size	1.1 1