Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABG320

[Submit comment/correction]

Locus	ABG320
Type	RFLP STS
Synonym	Synonym ABG320
Chromosome	7H
Chromosome Arm	7HS
Map	Barley-consensus-2003-7H 19.8 [ Show all 22 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 22 ]
Species	Hordeum vulgare
Probe	ABG320
Reference	Close TJ et al. (2009) Development and implementation of high-throughput SNP genotyping in barley. BMC Genomics 10:582. [ Show all 6 ]
Data Source	Blake, Tom 05.04.19 Close, Timothy J. Langridge, Peter J.
Remark	Number of populations contributing to the placement of ABG320 in the Barley, Consensus 2006 DArT maps = 1 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'
Possible Orthologs	ABG320-7H Xabg320-4B Xabg320-5D
Probe	ABG320
Locus	ABG320 Xabg320-4B Xabg320-5D ABG320-7H
External Databases	DDBJ EMBL GenBank
Type	Genomic STS
PCR primers	GATCCAACAGCAAGGAAAGA AGACGAGTGGACACATGATG
Sequence	L43979 ABG320
Source Species	Hordeum vulgare