Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABG387a

[Submit comment/correction]

Locus	ABG387a
Type	RFLP
Synonym	Synonym ABG387
Chromosome	1H
Map	Barley-Consensus2-1H 149.8 [ Show all 24 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus 2 [ Show all 24 ]
Species	Hordeum vulgare
Probe	ABG387
Reference	Close TJ et al. (2009) Development and implementation of high-throughput SNP genotyping in barley. BMC Genomics 10:582. [ Show all 6 ]
Data Source	Blake, Tom 05.04.19 Close, Timothy J.
Remark	Number of populations contributing to the placement of ABG387A in the Barley, Consensus 2006 DArT maps = 1 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Oregon Wolfe Barleys,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Oregon Wolfe Dom x Rec; Igri x Franka
Possible Orthologs	ABG387 [ Show all 14 ]
Probe for Locus	ABG387
Locus	ABG387a [ Show all 15 ]
Synonym	Synonym HAR35_1739
Type	Genomic STS
STS primers	5' GCACTGGCATAGTCTCACAA 5' CGATGCTGGTTCGGTCATAC
STS size	198
Amplification Conditions	STS annealing temperature 60-62 oC
Sequence	BH854352 ABG387-5
Source Species	Hordeum vulgare