Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABG388-6H

[Submit comment/correction]

Locus	ABG388-6H
Type	STS
Map	Hv-DxR-Stein-6H 56.67 Hv-IxF-Stein-6H 56.7
	[ Show Nearby Loci ]
Map Data	Barley, IxF, Stein2006 Barley, OWB, Stein2006
Probe	ABG388
Possible Orthologs	ABG388 Xabg388 Xabg388-6A
Probe for Locus	ABG388
Locus	ABG388 Xabg388-6A RI026L17 Xabg388 ABG388-6H
Reference	Abu Qamar M et al. (2008) A region of barley chromosome 6H harbors multiple major genes associated with net type net blotch resistance. Theoretical and Applied Genetics 117:1261-1270. Marcel TC et al. (2007) A high-density consensus map of barley to compare the distribution of QTLs for partial resistance to Puccinia hordei and of defence gene homologues. Theoretical and Applied Genetics 114:487-500. Kunzel G et al. (2000) Cytologically integrated physical restriction fragment length polymorphism maps for the barley genome based on translocation breakpoints Genetics 154:397-412.
General Remarks	Restriction Enzyme for CAPS marker is Nla III
Type	Genomic STS
STS primers	5' GCACTGGCATAGTCTCACAA 5' CGATGCTGGTTCGGTCATAC
STS size	303
Amplification Conditions	5 min at 94 deg C; 35 cycles with 30 sec at 94 deg C, 30 sec at 58 deg C, and 1 min at 72 deg C; and a final extension step of 7 min at 72 deg C
Sequence	BH854354 BH854353 ABG388-5 ABG388-3
Source Species	Hordeum vulgare