Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABG458A

[Submit comment/correction]

Locus	ABG458A
Type	RFLP STS
Chromosome	6H
Map	Hv-Consensus2006-Marcel-6H 56.11 Hv-Integrated2009-6H 55.5 Hv-L94/Vada-2006-6H 55.26
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2006, Marcel Barley, Integrated, Marcel 2009 Barley, L94 x Vada, 2006
Species	Hordeum vulgare
Probe	ABG458 ABG458A
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = L9Oregon Wolfe Barleys x Vada,Steptoe x Morex,Oregon Wolfe Barleys,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : L94 x Vada; Oregon Wolfe Dom x Rec; Steptoe x Morex; Igri x Franka
Possible Orthologs	ABG458 [ Show all 7 ]
Probe for Locus	ABG458
Locus	ABG458 [ Show all 6 ]
Reference	Abu Qamar M et al. (2008) A region of barley chromosome 6H harbors multiple major genes associated with net type net blotch resistance. Theoretical and Applied Genetics 117:1261-1270. Kunzel G et al. (2000) Cytologically integrated physical restriction fragment length polymorphism maps for the barley genome based on translocation breakpoints Genetics 154:397-412.
General Remarks	Restriction enzyme informative in CAP analysis is RsaI Shin Ebisu16 gDNA
Type	Genomic STS
STS primers	5' GAGAGCCGATGACGGTATGT 5' CTTGGACACATGCCATATCC
STS size	248
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	L43996 ABG458 ABG458-5
Linkage Group	6S
Source Species	Hordeum vulgare
Insert Size	0.4