Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABG701

[Submit comment/correction]

Locus	ABG701
Type	RFLP STS
Synonym	Synonym ABG701
Chromosome	7H
Chromosome Arm	7HL
Map	Barley-consensus-2003-7H 76.4 [ Show all 21 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 21 ]
Species	Hordeum vulgare
Probe	ABG701
Reference	Close TJ et al. (2009) Development and implementation of high-throughput SNP genotyping in barley. BMC Genomics 10:582. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Blake, Tom 05.04.19 Close, Timothy J. Langridge, Peter J.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'
Possible Orthologs	ABG701-7H
Probe	ABG701
Locus	ABG701 ABG701-7H
Synonym	Synonym HAR35_24214
External Databases	DDBJ EMBL GenBank
Type	Genomic PCR STS
PCR primers	CAACTGAATGCCAGCAATAC GAATACCTGTTGCCCAAAGA
Sequence	L44084 ABG701
Source Species	Hordeum vulgare