Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABG705

[Submit comment/correction]

Locus	ABG705
Type	RFLP
Chromosome	5H
Chromosome Arm	5HS
Map	Barley-consensus-2003-5H 21.7 [ Show all 16 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	MetaQ.FHB_4H_4 QDP.ANWI-5H
Map Data	Barley consensus [ Show all 15 ]
Species	Hordeum vulgare
Probe	ABG705
Reference	Close TJ et al. (2009) Development and implementation of high-throughput SNP genotyping in barley. BMC Genomics 10:582. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184. Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Data Source	Blake, Tom 05.04.19 Langridge, Peter J.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'
Possible Orthologs	ABG705-5H [ Show all 8 ]
Probe	ABG705
Locus	ABG705 [ Show all 11 ]
External Databases	DDBJ EMBL GenBank
Type	Genomic STS
PCR primers	CTAGAGTGCCTAGAAGATTG TTACTTAGAAAACCGATGAA
Sequence	L44087 ABG705
Source Species	Hordeum vulgare