Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABG710B

[Submit comment/correction]

Locus	ABG710B
Type	RFLP
Chromosome	1H
Map	Barley-Consensus2-1H 149.8 Hordeum-Bins-1H 152 Hordeum-Genes-1H -62.3 Hordeum-HxT-base-1H 150.7 Hordeum-NABGMP2-1H 147
	[ Show Nearby Loci ]
Map Data	Barley consensus 2 Barley genes Barley, BinMap 2005 Barley, HxT Barley, HxT basemap
Probe	ABG710
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin
Possible Orthologs	ABG710A
Probe for Locus	ABG710
Locus	ABG710B ABG710A
External Databases	DDBJ EMBL GenBank
Type	STS
PCR primers	GACTGGTCCGTCACGCTCTT TCACATGGGTATCCAAGATG
Sequence	L44091 ABG710
Source Species	Hordeum vulgare