Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABG72

[Submit comment/correction]

Locus	ABG72
Type	RFLP
Chromosome	2H
Chromosome Arm	2HL
Map	Barley-Consensus-2H 36.4 [ Show all 8 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 8 ]
Probe	ABG72
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Remark	Number of populations contributing to the placement of ABG72 in the Barley, Consensus 2006 DArT maps = 1 Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Oregon Wolfe Dom x Rec
Possible Orthologs	ABG072 ABG072-2H
Probe	ABG72
Locus	ABG72 ABG072 ABG072-2H
Synonym	Synonym HAR35_19063
External Databases	DDBJ EMBL GenBank
Type	Genomic STS
PCR primers	CTGCAACTAATTCCCTTCTA GATCCTCTAGAGTCGACCTG
Sequence	L44093 ABG72
Linkage Group	2
Source Species	Hordeum vulgare
Insert Size	0.7