Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ABG75

[Submit comment/correction]

Locus	ABG75
Type	RFLP
Synonym	Synonym ABG075
Chromosome	7H
Chromosome Arm	7HS
Map	Barley-consensus-2003-7H 10.4 [ Show all 6 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 6 ]
Probe	ABG75
Reference	Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Langridge, Peter J.
Remark	Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs	ABG075 ABG075-7H
Probe	ABG75
Locus	ABG75 ABG075 ABG075-7H
External Databases	DDBJ EMBL GenBank
Type	Genomic STS
PCR primers	CCATTAGTGACACAGGTGAG AGCATGTACAAGAACAGAAA
Sequence	L44094 ABG75
Source Species	Hordeum vulgare