Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: AF043094A

[Submit comment/correction]

Locus	AF043094A
Type	Microsatellite
Chromosome	4H 5H
Map	Barley, B73xCPI-4H 74.2 Barley-ConsensusFHB-5H 137.4 Hordeum-Consensus2006-DArT-4H 89.9 Hordeum-Consensus2007-SSR-5H 123.37 Hordeum-LxHs-5H 137
	[ Show Nearby Loci ]
Map Data	Barley, B73xCPI Barley, Consensus 2006, DArT Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB Barley, LxHs
Species	Hordeum spontaneum Hordeum vulgare
Probe	AF043094 AF043094A
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Number of populations contributing to the placement of AF043094A in the Barley, Consensus 2006 DArT maps = 1 Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : Lina x H. spontaneum Insert contains repeat (CTGT)5 Polymorphic Information Content (PIC) = 0.38 Developing laboratory = SCRI (R. Waugh)
Probe for Locus	AF043094
Locus	AF043094A
Reference	Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks	Insert contains repeat (CTGT)5 Quality = 2: Single product, relatively strong stutter bands Diversity Index (DI) = 0.38
Type	PCR SSR
PCR primers	5' CACGGTATAAATATCCACCC 3' 5' ATGGACTCTTCTCCCTGAA 3'
SSR size	146
Amplification Conditions	1 cycle of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 30 cycles of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare