Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: BCD269

[Submit comment/correction]

Locus	BCD269
Type	RFLP
Synonym	Other name bcd269
Chromosome	6H
Chromosome Arm	6HL
Map	Barley-consensus-2003-6H 75.5 [ Show all 16 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QAa.HaTR-6H QDp.HaTR-6H
Map Data	Barley consensus [ Show all 16 ]
Species	Avena sativa
Probe	BCD269
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
Data Source	Kleinhofs, Andris Langridge, Peter J.
Remark	Number of populations contributing to the placement of BCD269 in the Barley, Consensus 2006 DArT maps = 1 This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Marker placement value = 0.00 cM on map Oat-KxO/2003-33 Marker is a framework marker on map Oat-KxO/2003-33
Possible Orthologs	Xbcd269 Xcnl.BCD269
Probe	BCD269
Locus	BCD269 Xcnl.BCD269 Xbcd269
Reference	Heun M et al. (1991) Construction of a restriction fragment length polymorphism map for barley (Hordeum vulgare) Genome 34:437-447.
Remarks	Lambda ZAP II library Bar.LambZAPII [c]
Type	cDNA STS
PCR primers	CCAACACACACCATTACACC ATTCGGCACGAGCAATGGCT
Polymorphism	BCD269 EcoRI BCD269 EcoRV BCD269 DraI
Linkage Group	[b 6LS]
Insert Enzyme	EcoRI
Source Species	Hordeum vulgare
Source Germplasm	Willis
Source Tissue	etiolated leaf
Insert Size	1.1
PCR size	1.1