Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: BCD276

[Submit comment/correction]

Locus	BCD276
Type	CAPS RFLP
Chromosome	5H [ Show all 6 ]
Chromosome Arm	6AL 6BL 6DL 6HL
Map	Barley-consensus-2003-5H 28.5 [ Show all 10 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 11 ]
Species	Hordeum vulgare
Probe	BCD276
Homology	T14728 e-value: 4e-28 probable betaine-aldehyde dehydrogenase (EC 1.2.1.8) - sorghum (fragment) AC008263_15 e-value: 2e-61 (AC008263) Similar to gb from Amaranthus hypochondriacus. ESTs gb|T20662, gb|R90254, gb|AA651436 and gb|AA586226 come from this gene. [Arabidopsis thaliana] [Arabidopsis thaliana]
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
Data Source	Langridge, Peter J.
Remark	Number of populations contributing to the placement of BCD276 in the Barley, Consensus 2006 DArT maps = 1 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = L94 x Vada Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : L94 x Vada; Oregon Wolfe Dom x Rec
Possible Orthologs	Xbcd276 Xbcd276-6B
Probe	BCD276
Locus	BCD276 Xbcd276 Xbcd276-6B
Synonym	Synonym HAR35_15384 HAR35_2180 HAR35_2181
Reference	Marcel TC et al. (2007) A high-density consensus map of barley to compare the distribution of QTLs for partial resistance to Puccinia hordei and of defence gene homologues. Theoretical and Applied Genetics 114:487-500. Heun M et al. (1991) Construction of a restriction fragment length polymorphism map for barley (Hordeum vulgare) Genome 34:437-447.
Remarks	Lambda ZAP II library Restriction Enzyme for CAPS marker is MwoI Bar.LambZAPII [c]
Type	cDNA
PCR primers	5' ttgggccagttgttagtgaaggac 3' 5' caatttgcgtagccgatgataaca 3'
Amplification Conditions	5 min at 94 deg C; 35 cycles with 30 sec at 94 deg C, 30 sec at 63 deg C, and 1 min at 72 deg C; and a final extension step of 7 min at 72 deg C
Sequence	BE438689 BE438780 BCD276_WHE1A0061 BCD276_WHE1A0062
Polymorphism	Durums BCD276 EcoRI
Linkage Group	6L
Insert Enzyme	EcoRI
Source Species	Hordeum vulgare
Source Germplasm	Willis
Source Tissue	etiolated leaf
Insert Size	0.9
PCR size	0.9