Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: BMAG0900

[Submit comment/correction]

Locus	Bmag0900
Type	Microsatellite
Chromosome	7H
Map	Barley-ConsensusFHB-7H 75.16 Hordeum-Consensus2007-SSR-7H 75.68 Hv-Integrated2009-7H 85
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB Barley, Integrated, Marcel 2009
Species	Hordeum vulgare
Probe	BMAG0900 Bmag900
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' [ Show all 6 ]
Possible Orthologs	Bmag900
Probe for Locus	Bmag900
Locus	Bmag0900 Bmag900
Synonym	See also BMAG0900
Reference	Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks	Insert contains repeat (GA)25 Quality = 3: Strong major polymorphic product, with additional strong bands. Multi-locus or weak but scoreable products Diversity Index (DI) = 0.79
Type	PCR SSR
PCR primers	5' AGCCTGTGATACATCAAGATC 3' 5' AGGATGAGGGTATGTAGACG 3'
SSR size	122
Amplification Conditions	3 min 94C, 45 cycles of 1 min @94C, 1 min @55C, 2 min @72C, final extension of 10 min @72C. 25 microlitre reactions contained 125 nM of each primer.
Source Species	Hordeum vulgare