Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmac0035

[Submit comment/correction]

Locus	Bmac0035
Type	Microsatellite
Chromosome	7H
Map	Barley-ConsensusFHB-7H 135.23 Hordeum-Consensus2007-SSR-7H 129.19 Hordeum-LxHs-7H 151
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB Barley, LxHs
Species	Hordeum spontaneum Hordeum vulgare
Probe	Bmac0035 Bmac35
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : Lina x H. spontaneum Insert contains repeat (AT)10(AC)29 Developing laboratory = SCRI (R. Waugh)
Probe for Locus	Bmac35
Locus	Bmac0035
Synonym	Other name Bmac0035
Reference	Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks	Insert contains repeat (AT)10(AC)29 Quality = 5: Bands of unexpected size or additional bands. Very weak bands or no amplification products
Type	PCR SSR
PCR primers	5' TCTCATCATTTTTTTGGGTGG 3' 5' TGTGACCAAATACAAGAGGCC 3'
SSR size	168
Amplification Conditions	'Touchdown' PCR: 18 cycles of denaturing 1 min @94C and extension 1 min @72C, with annealing for 30s with temp decreased 1C every second cycel from 64C to 55C. Continue 30 cyclesfor 1 min @94C, 1 min @55C, 1 min @72C. End with 5 min @72C.
Source Species	Hordeum vulgare