Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmac0090

[Submit comment/correction]

Locus	Bmac0090
Type	Microsatellite
Synonym	Synonym Bmac90
Chromosome	1H
Map	Barley, B73xCPI-1H 52.3 [ Show all 7 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	MetaQ.FHB_1H_4 MetaQ.HD_1H_1 QFhs.umn-1H QHD.umn-1H
Map Data	Barley, B73xCPI [ Show all 7 ]
Species	Hordeum spontaneum Hordeum vulgare
Probe	Bmac0090 Bmac90
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Mesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' [ Show all 6 ]
Possible Orthologs	Bmac90
Probe for Locus	Bmac90
Locus	Bmac0090 Bmac90
Synonym	Other name Bmac0090
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks	Insert contains repeat (AC)20 Quality = 2: Single product, relatively strong stutter bands
Type	PCR SSR
PCR primers	5' ACATCAACCCTCCTGCTC 3' 5' CCGCACATAGTGGTTACATC 3' ACATCAACCCTCCTGCTC CCGCACATAGTGGTTACATC
SSR size	221
Amplification Conditions	1 cycle of 3 min @ 94C, 1 min @ 58C, 1 min @ 72C, 30 cycles of 30 secs @ 94C, 30 secs @ 58C, 30 secs @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare