Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmac0127a

[Submit comment/correction]

Locus	Bmac0127a
Type	Microsatellite
Synonym	Synonym Bmac127
Chromosome	6H
Map	Barley-ConsensusFHB-6H 59.5 [ Show all 9 ]
	[ Show Nearby Loci ]
Map Data	Barley, Abiotic QTL Consensus [ Show all 9 ]
Species	Hordeum spontaneum Hordeum vulgare
Probe	Bmac0127 Bmac127
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' [ Show all 6 ]
Possible Orthologs	Bmac127 Bmac0127b
Probe for Locus	Bmac0127
Locus	Bmac0127b Bmac0127a
Synonym	Other name Bmac127
Reference	Hayden MJ et al. (2008) Multiplex-Ready PCR: A new method for multiplexed SSR and SNP genotyping BMC Genomics 9:80. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Type	SSR
PCR primers	AACTATGTCCAGTCGTTTCC CTTGTCGTATCATCTTATTCAGA Forward AACTATGTCCAGTCGTTTCC Reverse CTTGTCGTATCATCTTATTCAGA