Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmac0209

[Submit comment/correction]

Locus	Bmac0209
Type	Microsatellite
Synonym	Synonym Bmac209
Chromosome	3H
Map	Barley, B73xCPI-3H 46.1 [ Show all 17 ]
	[ Show Nearby Loci ]
Map Data	Barley, Abiotic QTL Consensus [ Show all 18 ]
Species	Hordeum spontaneum Hordeum vulgare
Probe	Bmac0209 Bmac209
Reference	Szucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Locus position not reported in Cebada Capa x SusPtrit map [ Show all 8 ]
Possible Orthologs	Bmac209
Probe for Locus	Bmac209
Locus	Bmac0209 Bmac209
Synonym	Other name Bmac0209
Reference	Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks	Insert contains repeat (AC)13 Quality = 1: Single product, only weak stutter bands Diversity Index (DI) = 0.64
Type	PCR SSR
PCR primers	5' CTAGCAACTTCCCAACCGAC 3' 5' ATGCCTGTGTGTGGACCAT 3'
SSR size	176
Amplification Conditions	1 cycle of 3 min @ 94C, 1 min @ 58C, 1 min @ 72C, 30 cycles of 30 secs @ 94C, 30 secs @ 58C, 30 secs @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare