Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmac0222

[Submit comment/correction]

Locus	Bmac0222
Type	Microsatellite
Synonym	Synonym Bmac222
Chromosome	2H
Map	Barley, B73xCPI-5H 155.3 [ Show all 8 ]
	[ Show Nearby Loci ]
Map Data	Barley, Abiotic QTL Consensus [ Show all 8 ]
Species	Hordeum spontaneum Hordeum vulgare
Probe	Bmac0222 Bmac222
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : Lina x H. spontaneum Insert contains repeat (AC)23 Developing laboratory = SCRI (R. Waugh)
Possible Orthologs	Bmac222
Probe for Locus	Bmac222
Locus	Bmac0222 Bmac222
Synonym	Other name Bmac0222
Reference	Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks	Insert contains repeat (AC)23 Quality = 2: Single product, relatively strong stutter bands Null in H. spontaneum Canada Park.
Type	PCR SSR
PCR primers	5' ATTTGAATGTCCAACAGAATC 3' 5' GGGACTAAAGCCCCTTAC 3'
SSR size	165
Amplification Conditions	1 cycle of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 30 cycles of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare