Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmac0297b

[Submit comment/correction]

Locus	Bmac0297b
Type	Microsatellite
Chromosome	4H
Map	Hordeum-Consensus2007-SSR-4H 58.51 Hordeum-LxHs-4H 46
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2007, SSR Barley, LxHs
Species	Hordeum spontaneum Hordeum vulgare
Probe	Bmac0297 Bmac297
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : Lina x H. spontaneum Insert contains repeat (AC)9(AC)10 Developing laboratory = SCRI (R. Waugh)
Possible Orthologs	Bmac297 [ Show all 6 ]
Probe for Locus	Bmac0297
Locus	Bmac0297b [ Show all 6 ]
Synonym	Other name Bmac297
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Type	SSR
PCR primers	ATAGAGGGGGTGAAGAATAAC AATAAGTGAATGATGTTGAGGA