Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmac0518

[Submit comment/correction]

Locus	Bmac0518
Type	Microsatellite
Chromosome	5H
Map	Hordeum-Consensus2005-SNP-5H 55.999 Hordeum-LiHs-SNP-5H 42.14 Hordeum-QTLConsensus-Abiotic-5H 56 Hordeum-QTLConsensus-Agronomic-5H 56
	[ Show Nearby Loci ]
Map Data	Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, Consensus 2005, SNP Barley, Lina x H.spont, SNP
Probe	Bmac0518
Reference	Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Possible Orthologs	EBmac0518
Probe	Bmac0518
Locus	EBmac0518 Bmac0518
Synonym	Other name EBmac518
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Type	SSR
PCR primers	ATATGGGTCACACTGAAAATC AGTTTGTTTTTACCAATAAGAGTG