Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmac0577

[Submit comment/correction]

Locus	Bmac0577
Type	Microsatellite
Synonym	Synonym Bmac577
Chromosome	4H
Map	Barley-ConsensusFHB-4H 69.31 [ Show all 7 ]
	[ Show Nearby Loci ]
Map Data	Barley, Abiotic QTL Consensus [ Show all 7 ]
Species	Hordeum spontaneum Hordeum vulgare
Probe	Bmac0577 Bmac577
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : Lina x H. spontaneum Insert contains repeat (AC)12 Developing laboratory = SCRI (R. Waugh)
Possible Orthologs	Bmac577
Probe for Locus	Bmac577
Locus	Bmac0577 Bmac577
Reference	Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks	Insert contains repeat (AC)12 Quality = 4: Ladders of bands that are at equal intensity, but may contain scoreable weak products
Type	PCR SSR
PCR primers	5' TCATACAGAAGCCCACACAG 3' 5' TGCATGTTCATTCTAGACAGG 3'
SSR size	146
Amplification Conditions	1 cycle of 3 min @ 94C, 1 min @ 58C, 1 min @ 72C, 30 cycles of 30 secs @ 94C, 30 secs @ 58C, 30 secs @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare