Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmac134

[Submit comment/correction]

Locus	Bmac134
Type	Microsatellite
Synonym	Synonym Bmac0134
Chromosome	2H
Map	Barley-consensus-2003-2H 3.4 Hordeum-IxF-SSR-2H 0 Hordeum-Zhedar2-FHB-QTL-2H 10 Hv-HNxH602-2H 26.7
	[ Show Nearby Loci ]
Map Data	Barley consensus 2003 Barley, HN x H602, Sato2009 Barley, Igri x Franka, SSR Barley, Zhedar2, FHB QTL
Species	Hordeum vulgare Hordeum vulgare subsp. spontaneum
Probe	Bmac134
Reference	Sato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117. Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Data Source	Langridge, Peter J.
Possible Orthologs	Bmac0134 Bmac134a Bmac134b
Probe	Bmac134
Locus	Bmac0134 Bmac134 Bmac134a Bmac134b
Synonym	Other name Bmac0134
Reference	Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remarks	Insert contains repeat (AC)28 Quality = 2: Single product, relatively strong stutter bands Diversity Index (DI) = 0.76
Type	PCR SSR
PCR primers	5' CCAACTGAGTCGATCTCG 3' 5' CTTCGTTGCTTCTCTACCTT 3'
SSR size	148
Amplification Conditions	1 cycle of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 30 cycles of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare