Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmac18

[Submit comment/correction]

Locus	Bmac18
Type	Microsatellite
Synonym	Synonym Bmac0018
Chromosome	6H
Map	Hordeum-Consensus2006-DArT-6H 68.2
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2006, DArT Barley, Steptoe x Morex, SSR
Probe	Bmac18
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
Remark	Number of populations contributing to the placement of Bmac18 in the Barley, Consensus 2006 DArT maps = 2
Possible Orthologs	Bmac0018
Probe	Bmac18
Locus	Bmac0018 Bmac18
Synonym	Other name Bmac0018
Reference	Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remarks	Insert contains repeat (AC)11 Quality = 1: Single product, only weak stutter bands Diversity Index (DI) = 0.59
Type	PCR SSR
PCR primers	5' GTCCTTTACGCATGAACCGT 3' 5' ACATACGCCAGACTCGTGTG 3'
SSR size	138
Amplification Conditions	1 cycle of 3 mins @ 94C, 1 min @ 66C, 1 min @ 72C, 5 cycles of 30 secs @ 94C, 30 secs @ 65C (decreasing 1C per cycle), 30 secs @ 72C, 24 cycles of 30 secs @ 94C, 30 secs @ 60C, 30 secs @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare