Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmac31

[Submit comment/correction]

Locus	Bmac31
Type	Microsatellite
Synonym	Synonym Bmac0031
Chromosome	7H
Map	Hordeum-Consensus2006-DArT-7H 87.4 Hordeum-IxF-SSR-7H 58.9
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2006, DArT Barley, Igri x Franka, SSR
Probe	Bmac31
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Remark	Number of populations contributing to the placement of Bmac31 in the Barley, Consensus 2006 DArT maps = 2
Possible Orthologs	Bmac0031 Bmac31a Bmac31b
Probe	Bmac31
Locus	Bmac0031 Bmac31 Bmac31a Bmac31b
Synonym	Other name Bmac0031
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remarks	Insert contains repeat (AC)28 Quality = 2: Single product, relatively strong stutter bands Diversity Index (DI) = 0.37
Type	PCR SSR
PCR primers	5' AGAGAAAGAGAAATGTCACCA 3' 5' ATACATCCATGTGAGGGC 3' AGAGAAAGAGAAATGTCACCA ATACATCCATGTGAGGGC
SSR size	175
Amplification Conditions	1 cycle of 3 mins @ 94C, 1 min @ 66C, 1 min @ 72C, 5 cycles of 30 secs @ 94C, 30 secs @ 65C (decreasing 1C per cycle), 30 secs @ 72C, 24 cycles of 30 secs @ 94C, 30 secs @ 60C, 30 secs @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare