Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmac311

[Submit comment/correction]

Locus	Bmac311
Type	Microsatellite
Synonym	Synonym Bmac0311
Chromosome	7H
Map	Hordeum-Consensus2006-DArT-7H 58.4
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2006, DArT
Probe	Bmac311
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
Remark	Number of populations contributing to the placement of Bmac311 in the Barley, Consensus 2006 DArT maps = 1
Possible Orthologs	Bmac0311
Probe	Bmac311
Locus	Bmac0311 Bmac311
Synonym	Other name Bmac0311
Reference	Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remarks	Insert contains repeat (AC)28(AT)9 Quality = 4: Ladders of bands that are at equal intensity, but may contain scoreable weak products
Type	PCR SSR
PCR primers	5' ATTGATGGAGCATTGTCC 3' 5' AAGTGTGGAAGGATAGTAGCA 3'
SSR size	235
Amplification Conditions	1 cycle of 3 min @ 94C, 1 min @ 69C, 1 min @ 72C, 5 cycles of 30 secs @ 94C, 30 secs @ 68C (decreasing 1C per cycle), 30 secs @ 72C, 24 cycles of 30 secs @ 94C, 30 secs @ 63C, 30 secs @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare