Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmac67

[Submit comment/correction]

Locus	Bmac67
Type	Microsatellite
Synonym	Synonym Bmac0067
Chromosome	3H
Map	Barley-consensus-2003-3H 55 Hordeum-Consensus2006-DArT-3H 66.2 Hv-HNxH602-3H 89.6
	[ Show Nearby Loci ]
Map Data	Barley consensus 2003 Barley, Consensus 2006, DArT Barley, HN x H602, Sato2009
Species	Hordeum vulgare Hordeum vulgare subsp. spontaneum
Probe	Bmac67
Reference	Sato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117. Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
Data Source	Langridge, Peter J.
Remark	Number of populations contributing to the placement of Bmac67 in the Barley, Consensus 2006 DArT maps = 4
Possible Orthologs	Bmac0067
Probe	Bmac67
Locus	Bmac0067 Bmac67
Synonym	Other name Bmac0067
Reference	Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remarks	Insert contains repeat (AC)18 Quality = 1: Single product, only weak stutter bands Diversity Index (DI) = 0.82
Type	PCR SSR
PCR primers	5' AACGTACGAGCTCTTTTTCTA 3' 5' ATGCCAACTGCTTGTTTAG 3'
SSR size	171
Amplification Conditions	1 cycle of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 30 cycles of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare