Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmag0112.7H

[Submit comment/correction]

Locus	Bmag0112.7H
Type	Microsatellite
Map	Barley, B73xCPI-7H 85.7
	[ Show Nearby Loci ]
Map Data	Barley, B73xCPI
Probe	Bmag0112
Possible Orthologs	Bmag0112 Bmag112 Bmag0112.3H Bmag112a Bmag112b
Probe for Locus	Bmag0112
Locus	Bmag0112.3H Bmag0112.7H Bmag0112
Synonym	Other name Bmag112
Reference	Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Type	SSR
PCR primers	CCCGTGATATATTAAGATCATG AGGGGGAGATCTTCTCTG