Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmag0140

[Submit comment/correction]

Locus	Bmag0140
Type	Microsatellite
Chromosome	2H
Map	Barley, B73xCPI-2H 74.4 [ Show all 6 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	MetaQ.FHB_2H_18 MetaQ.FHB_2H_25 MetaQ.HD_2H_14 MetaQ.HT_2H_8
Map Data	Barley, B73xCPI [ Show all 6 ]
Species	Hordeum spontaneum Hordeum vulgare
Probe	Bmag0140 Bmag140
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' [ Show all 6 ]
Possible Orthologs	Bmag140
Probe for Locus	Bmag140
Locus	Bmag0140 Bmag140
Synonym	Other name Bmag0140
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks	Insert contains repeat (AG)15 Quality = 1: Single product, only weak stutter bands Diversity Index (DI) = 0.35
Type	PCR SSR
PCR primers	5' GCGATCCCATATACTTGTG 3' 5' TCGGATTTAAGTATCTCTGGA 3' GCGATCCCATATACTTGTG TCGGATTTAAGTATCTCTGGA
SSR size	157
Amplification Conditions	1 cycle of 3 min @ 94C, 1 min @ 58C, 1 min @ 72C, 30 cycles of 30 secs @ 94C, 30 secs @ 58C, 30 secs @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare