Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmag0210

[Submit comment/correction]

Locus	Bmag0210
Type	Microsatellite
Chromosome	6H
Map	Barley, B73xCPI-6H 47.8 Barley-ConsensusFHB-6H 59.5 Hordeum-Consensus2007-SSR-6H 62.28 Hv-Integrated2009-6H 58.9
	[ Show Nearby Loci ]
Map Data	Barley, B73xCPI Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB Barley, Integrated, Marcel 2009
Species	Hordeum vulgare
Probe	Bmag0210 Bmag210
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' [ Show all 6 ]
Possible Orthologs	Bmag210
Probe for Locus	Bmag210
Locus	Bmag0210 Bmag210
Synonym	Other name Bmag0210
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Type	SSR
PCR primers	ACCTACAGTTCAATAGCTAGTACC GCACAAAACGATTACATCATA