Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmag0344

[Submit comment/correction]

Probe	Bmag0344
Locus	Bmag0344c Bmag0344b Bmag0344a
Synonym	Other name Bmag344
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Type	SSR
PCR primers	GATCCAACTATATTAACAAAGCC TGAGGGTATGTACCACTAGCT