Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmag0350

[Submit comment/correction]

Locus	Bmag0350
Type	Microsatellite
Map	Barley, B73xCPI-2H 71.7 Barley-ConsensusFHB-2H 73.03
	[ Show Nearby Loci ]
Map Data	Barley, B73xCPI Barley, Consensus 2023, FHB
Probe	Bmag0350
Possible Orthologs	Bmag350 Bmag0350a Bmag0350b Bmag0350c Bmag0350d
Probe	Bmag0350
Locus	Bmag0350 Bmag0350c Bmag0350a Bmag0350b Bmag0350d
Synonym	Other name Bmag350
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Type	SSR
PCR primers	AGCTAGATCTCTCTGTCTCTGTC AAGAAACACACCACAAAGATT