Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmag0606

[Submit comment/correction]

Locus	Bmag0606
Type	Microsatellite
Synonym	Synonym Bmag606
Chromosome	3H
Map	Barley, B73xCPI-3H 79.5 [ Show all 11 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	MetaQ.FHB_3H_5 MetaQ.HD_3H_1 QFhs.umn-3H.2 QHD.umn-3H
Map Data	Barley, Abiotic QTL Consensus [ Show all 11 ]
Species	Hordeum spontaneum Hordeum vulgare
Probe	Bmag0606 Bmag606
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Mesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' [ Show all 6 ]
Possible Orthologs	Bmag606
Probe for Locus	Bmag606
Locus	Bmag0606 Bmag606
Synonym	Other name Bmag0606
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks	Insert contains repeat (CT)22 Quality = 2: Single product, relatively strong stutter bands Diversity Index (DI) = 0.87
Type	PCR SSR
PCR primers	5' CTATTTGTAATGTATGTATGTCCC 3' 5' TCATTGGTCCAGATAATACAA 3' CTATTTGTAATGTATGTATGTCCC TCATTGGTCCAGATAATACAA
SSR size	140
Amplification Conditions	1 cycle of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 30 cycles of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare