Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmag0740

[Submit comment/correction]

Locus	Bmag0740
Type	Microsatellite
Chromosome	4H
Map	Barley, B73xCPI-4H 53.6 Barley-ConsensusFHB-4H 65.3 Hordeum-Consensus2007-SSR-4H 50.86 Hordeum-FxS-FHB-QTL-4H 141.3 Hv-Integrated2009-4H 60.9
	[ Show Nearby Loci ]
Map Data	Barley, B73xCPI Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB Barley, FxS, FHB QTL Barley, Integrated, Marcel 2009
Species	Hordeum vulgare
Probe	Bmag0740 Bmag740
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Mesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' [ Show all 6 ]
Possible Orthologs	Bmag740
Probe for Locus	Bmag740
Locus	Bmag0740 Bmag740
Synonym	Other name Bmag0740
Reference	Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks	Insert contains repeat (CT)28 Quality = 2: Single product, relatively strong stutter bands Diversity Index (DI) = 0.78
Type	PCR SSR
PCR primers	5' ATTGTCATGGAGGTGAGTG 3' 5' AAGAACACCATATGACTCGAC 3'
SSR size	150
Amplification Conditions	3 min 94C, 45 cycles of 1 min @94C, 1 min @55C, 2 min @72C, final extension of 10 min @72C. 25 microlitre reactions contained 125 nM of each primer.
Source Species	Hordeum vulgare