Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmag125

[Submit comment/correction]

Locus	Bmag125
Type	Microsatellite
Synonym	Synonym Bmag0125
Chromosome	2H
Map	Barley-consensus-2003-2H 91.6 Hordeum-Consensus2006-DArT-2H 95.4 Hordeum-IxF-SSR-2H 120.3 Hv-Consensus2006-Marcel-2H 89.83 Hv-HNxH602-2H 180.9
	[ Show Nearby Loci ]
Map Data	Barley consensus 2003 [ Show all 6 ]
Species	Hordeum vulgare Hordeum vulgare subsp. spontaneum
Probe	Bmag125
Reference	Sato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117. Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Data Source	Langridge, Peter J.
Remark	Number of populations contributing to the placement of Bmag125 in the Barley, Consensus 2006 DArT maps = 2 Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : L94 x Vada; Oregon Wolfe Dom x Rec; Steptoe x Morex; Igri x Franka
Possible Orthologs	Bmag0125
Probe	Bmag125
Locus	Bmag0125 Bmag125
Synonym	Other name Bmag0125
Reference	Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remarks	Insert contains repeat (AG)19 Quality = 2: Single product, relatively strong stutter bands Diversity Index (DI) = 0.76
Type	PCR SSR
PCR primers	5' AATTAGCGAGAACAAAATCAC 3' 5' AGATAACGATGCACCACC 3'
SSR size	134
Amplification Conditions	1 cycle of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 30 cycles of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare