Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmag136

[Submit comment/correction]

Locus	Bmag136
Type	Microsatellite
Synonym	Synonym Bmag0136
Chromosome	3H
Map	Hordeum-Consensus2006-DArT-3H 66.2 Hv-Consensus2006-Marcel-3H 52.09 Hv-HNxH602-3H 103.4
	[ Show Nearby Loci ]
QTL with Locus Marker	QHt.TaER-3H.1 QPc.TaER-3H.1 QYld.TaER-3H.1
Map Data	Barley, Consensus 2006, DArT Barley, Consensus 2006, Marcel Barley, HN x H602, Sato2009
Species	Hordeum vulgare Hordeum vulgare subsp. spontaneum
Probe	Bmag136
Reference	Sato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117. Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
Remark	Number of populations contributing to the placement of Bmag136 in the Barley, Consensus 2006 DArT maps = 1 Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : L94 x Vada; Oregon Wolfe Dom x Rec; Vada x SusPtrit
Possible Orthologs	Bmag0136
Probe	Bmag136
Locus	Bmag0136 Bmag136
Synonym	Other name Bmag0136
Reference	Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remarks	Insert contains repeat (AG)6-(AG)10-(AG)6 Quality = 2: Single product, relatively strong stutter bands Diversity Index (DI) = 0.33
Type	PCR SSR
PCR primers	5' GTACGCTTTCAAACCTGG 3' 5' GTAGGAGGAAGAATAAGGAGG 3'
SSR size	197
Amplification Conditions	1 cycle of 3 min @ 94C, 1 min @ 58C, 1 min @ 72C, 30 cycles of 30 secs @ 94C, 30 secs @ 58C, 30 secs @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare