Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmag381

[Submit comment/correction]

Locus	Bmag381
Type	Microsatellite
Synonym	Synonym Bmag0381
Chromosome	2H
Map	Barley-consensus-2003-2H 71.5 Hordeum-Consensus2006-DArT-2H 84.8
	[ Show Nearby Loci ]
Map Data	Barley consensus 2003 Barley, Consensus 2006, DArT
Probe	Bmag381
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
Data Source	Langridge, Peter J.
Remark	Number of populations contributing to the placement of Bmag381 in the Barley, Consensus 2006 DArT maps = 1
Possible Orthologs	Bmag0381
Probe	Bmag381
Locus	Bmag0381 Bmag381
Synonym	Other name Bmag0381
Reference	Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remarks	Insert contains repeat (CT)7(ATCT)6(CT)14 Quality = 2: Single product, relatively strong stutter bands Null in H. spontaneum Canada Park.
Type	PCR SSR
PCR primers	5' TTTTATTATTGCATCTAGGGC 3' 5' TATCAAGATCATGACGTCTCA 3'
SSR size	141
Amplification Conditions	1 cycle of 3 mins @ 94C, 1 min @ 66C, 1 min @ 72C, 5 cycles of 30 secs @ 94C, 30 secs @ 65C (decreasing 1C per cycle), 30 secs @ 72C, 24 cycles of 30 secs @ 94C, 30 secs @ 60C, 30 secs @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare