Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmag387

[Submit comment/correction]

Locus	Bmag387
Type	Microsatellite
Synonym	Synonym Bmag0387
Chromosome	5H
Map	Barley-consensus-2003-5H 28.5 Hordeum-Consensus2006-DArT-5H 51 Hv-Consensus2006-Marcel-5H 44.99
	[ Show Nearby Loci ]
Map Data	Barley consensus 2003 Barley, Consensus 2006, DArT Barley, Consensus 2006, Marcel Barley, Steptoe x Morex, SSR
Probe	Bmag387
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
Data Source	Langridge, Peter J.
Remark	Number of populations contributing to the placement of Bmag387 in the Barley, Consensus 2006 DArT maps = 2 Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs	Bmag0387
Probe	Bmag387
Locus	Bmag0387 Bmag387
Synonym	Other name Bmag0387
Reference	Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remarks	Insert contains repeat (AG)16 Quality = 2: Single product, relatively strong stutter bands Diversity Index (DI) = 0.67
Type	PCR SSR
PCR primers	5' CGATGACCATTGTATTGAAG 3' 5' CTCATGTTGATGTGTGGTTAG 3'
SSR size	123
Amplification Conditions	1 cycle of 3 min @ 94C, 1 min @ 58C, 1 min @ 72C, 30 cycles of 30 secs @ 94C, 30 secs @ 58C, 30 secs @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare