Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmag490

[Submit comment/correction]

Locus	Bmag490
Type	Microsatellite
Chromosome	4H
Map	Hordeum-Consensus2006-DArT-4H 72.2 Hordeum-SxM-SSR-4H 80.3 Hv-Consensus2006-Marcel-4H 62.19
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2006, DArT Barley, Consensus 2006, Marcel Barley, Steptoe x Morex, SSR
Probe	Bmag490
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Remark	Number of populations contributing to the placement of Bmag490 in the Barley, Consensus 2006 DArT maps = 1 Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs	Bmag0490
Probe	Bmag490
Locus	Bmag0490 Bmag490
Synonym	Other name Bmag0490
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remarks	Insert contains repeat (AG)24 Quality = 2: Single product, relatively strong stutter bands Diversity Index (DI) = 0.73
Type	PCR SSR
PCR primers	5' TGATACATCAAGATCGTGACA 3' 5' GGGACTGAGTGTATGAATGAG 3' TGATACATCAAGATCGTGACA GGGACTGAGTGTATGAATGAG
SSR size	121
Amplification Conditions	1 cycle of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 30 cycles of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare