Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmag500

[Submit comment/correction]

Locus	Bmag500
Type	Microsatellite
Synonym	Synonym Bmag0500
Chromosome	6H
Map	Hordeum-Consensus2006-DArT-6H 24 Hordeum-IxF-SSR-6H 0 Hv-Consensus2006-Marcel-6H 31.65
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2006, DArT Barley, Consensus 2006, Marcel Barley, Igri x Franka, SSR
Probe	Bmag500
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Remark	Number of populations contributing to the placement of Bmag500 in the Barley, Consensus 2006 DArT maps = 2 Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs	Bmag0500 Bmag507 Bmag507-7H Xmag500.1 Xmag500.2
Probe	Bmag500
Locus	Bmag0500 Bmag500
Synonym	Other name Bmag0500
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remarks	Insert contains repeat (AG)6CG(AG)29(AGAGGG)3(AG)6 Quality = 1: Single product, only weak stutter bands Diversity Index (DI) = 0.8
Type	PCR SSR
PCR primers	5' GGGAACTTGCTAATGAAGAG 3' 5' AATGTAAGGGAGTGTCCATAG 3' GGGAACTTGCTAATGAAGAG AATGTAAGGGAGTGTCCATAG
SSR size	150
Amplification Conditions	1 cycle of 3 min @ 94C, 1 min @ 58C, 1 min @ 72C, 30 cycles of 30 secs @ 94C, 30 secs @ 58C, 30 secs @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare