Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmag508A

[Submit comment/correction]

Locus	Bmag508A
Type	Microsatellite
Chromosome	3H
Map	Hordeum-Consensus2006-DArT-3H 66.2
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2006, DArT
Probe	Bmag508
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
Remark	Number of populations contributing to the placement of Bmag508A in the Barley, Consensus 2006 DArT maps = 1 No probe information for this marker is currently available. Curator Note: May 2018. Please contact the GrainGenes curators if you have information about using this marker.
Possible Orthologs	Bmag0513
Probe for Locus	Bmag508
Locus	Bmag0508A Bmag508 Bmag508A
Synonym	Other name Bmag0508 Bmag0508A
Reference	Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
General Remarks	Insert contains repeat (AG)14 Quality = 2: Single product, relatively strong stutter bands Diversity Index (DI) = 0.14
Type	PCR SSR
PCR primers	5' TCTCCGTATATTTAGGAAACG 3' 5' TATCTCCCCCTAGATAGAAGG 3'
SSR size	175
Amplification Conditions	1 cycle of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 30 cycles of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 1 cycle of 5 mins @ 72C.
Source Species	Hordeum vulgare