Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmag564

[Submit comment/correction]

Locus	Bmag564
Type	Microsatellite
Chromosome	7H
Map	Hordeum-Consensus2006-DArT-7H 79.1
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2006, DArT
Probe	Bmag0564
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
Remark	Number of populations contributing to the placement of Bmag564 in the Barley, Consensus 2006 DArT maps = 1
Possible Orthologs	Bmag0564
Probe for Locus	Bmag0564
Locus	Bmag0564 Bmag564
Synonym	Other name Bmag564
Reference	Hayden MJ et al. (2008) Multiplex-Ready PCR: A new method for multiplexed SSR and SNP genotyping BMC Genomics 9:80.
PCR primers	Forward GTCATCGTCCGTTCTTTG Reverse ATGTAGCTAGATGTCCACCC