Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmag711

[Submit comment/correction]

Locus	Bmag711
Type	Microsatellite
Chromosome	2H
Map	Hordeum-Consensus2006-DArT-2H 83.1 Hordeum-SxM-SSR-2H 105.8 Hv-Consensus2006-Marcel-2H 79.52
	[ Show Nearby Loci ]
Map Data	Barley, Consensus 2006, DArT Barley, Consensus 2006, Marcel Barley, Steptoe x Morex, SSR
Probe	Bmag711
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Remark	Number of populations contributing to the placement of Bmag711 in the Barley, Consensus 2006 DArT maps = 1 Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs	Bmag0711
Probe	Bmag711
Locus	Bmag0711 Bmag711
Synonym	Other name Bmag0711
Reference	Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remarks	Insert contains repeat (GA)21 Quality = 3: Strong major polymorphic product, with additional strong bands. Multi-locus or weak but scoreable products Diversity Index (DI) = 0.84
Type	PCR SSR
PCR primers	5' GGAGAGTCACATATCAAGGAC 3' 5' CCACTCCTTCTCATACCTTTA 3'
SSR size	192
Amplification Conditions	3 min 94C, 45 cycles of 1 min @94C, 1 min @55C, 2 min @72C, final extension of 10 min @72C. 25 microlitre reactions contained 125 nM of each primer.
Source Species	Hordeum vulgare