Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Bmag877

[Submit comment/correction]

Locus	Bmag877
Type	Microsatellite
Chromosome	3H
Map	Barley-consensus-2003-3H 118 Barley-ConsensusFHB-3H 134.79 Hordeum-Consensus2006-DArT-3H 141 Hordeum-SxM-SSR-3H 185.8 Hv-Consensus2006-Marcel-3H 124.98
	[ Show Nearby Loci ]
Map Data	Barley consensus 2003 Barley, Consensus 2006, DArT Barley, Consensus 2006, Marcel Barley, Consensus 2023, FHB Barley, Steptoe x Morex, SSR
Probe	Bmag877
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Data Source	Langridge, Peter J.
Remark	Number of populations contributing to the placement of Bmag877 in the Barley, Consensus 2006 DArT maps = 2 Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs	Bmag0877
Probe	Bmag877
Locus	Bmag877 Bmag0877
Synonym	See also BMAG0877
Reference	Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remarks	Insert contains repeat (GA)15 Quality = 2: Single product, relatively strong stutter bands Diversity Index (DI) = 0.77
Type	PCR SSR
PCR primers	5' AAAGCTCATGGTAGATCAAGA 3' 5' TAGTTTTCCCAAAAGCTTCTA 3'
SSR size	153
Amplification Conditions	3 min 94C, 45 cycles of 1 min @94C, 1 min @55C, 2 min @72C, final extension of 10 min @72C. 25 microlitre reactions contained 125 nM of each primer.
Source Species	Hordeum vulgare